Please use this identifier to cite or link to this item:
http://dspace.mediu.edu.my:8181/xmlui/handle/123456789/3447Full metadata record
| DC Field | Value | Language |
|---|---|---|
| dc.creator | ANUNCIAÇÃO CARLOS EDUARDO | - |
| dc.creator | ASTOLFI-FILHO SPARTACO | - |
| dc.date | 2000 | - |
| dc.date.accessioned | 2013-05-30T01:56:38Z | - |
| dc.date.available | 2013-05-30T01:56:38Z | - |
| dc.date.issued | 2013-05-30 | - |
| dc.identifier | http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000012 | - |
| dc.identifier | http://www.doaj.org/doaj?func=openurl&genre=article&issn=0100204X&date=2000&volume=35&issue=10&spage=2007 | - |
| dc.identifier.uri | http://koha.mediu.edu.my:8181/jspui/handle/123456789/3447 | - |
| dc.description | GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively. | - |
| dc.publisher | Empresa Brasileira de Pesquisa Agropecuária (Embrapa) | - |
| dc.source | Pesquisa Agropecuária Brasileira | - |
| dc.subject | breeding methods | - |
| dc.subject | molecular cloning | - |
| dc.subject | progeny testing | - |
| dc.subject | horses | - |
| dc.subject | identification | - |
| dc.subject | genetic polymorphism | - |
| dc.title | Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting | - |
| Appears in Collections: | Agriculture and Food Sciences | |
Files in This Item:
There are no files associated with this item.
Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.